lenticrispr v2 backbone (Addgene inc)

Addgene inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Addgene inc lenticrispr v2 backbone
Lenticrispr V2 Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 6093 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrispr+v2+backbone/lentiCRISPR+v2+(Plasmid+%2352961)/bio_rxiv__64898__2026__03__27__714872-282-6-14
Average 96 stars, based on 6093 article reviews

lenticrispr v2 backbone - by Bioz Stars, 2026-09

96/100 stars

Images

Plasmid Preparation:

Article Title: Genome-wide CRISPR screen identifies BUB1 kinase as a druggable vulnerability in malignant pleural mesothelioma.
Article Snippet: .. The gRNAs were inserted into the pECPV plasmid (EFS-Cas9-P2A-Venus), derived from the lentiCRISPR v2 backbone (Addgene plasmid #52961) by replacing the puromycin selection cassette with the Venus coding sequence [25, 73]. .. MeT-5A, H2052, H2452, and H28 parental cell lines were partially infected, and Venus-positive cells were monitored over time through flow cytometry (LSRFortessa, BD), starting on Day 0 (post-infection Day 5) and continuing with measurements at Days 4, 8, 11, 16, and 21.

Article Title: Genome-wide CRISPR screen identifies BUB1 kinase as a druggable vulnerability in malignant pleural mesothelioma
Article Snippet: .. The gRNAs were inserted into the pECPV plasmid (EFS-Cas9-P2A-Venus), derived from the lentiCRISPR v2 backbone (Addgene plasmid #52961) by replacing the puromycin selection cassette with the Venus coding sequence [ , ]. .. MeT-5A, H2052, H2452, and H28 parental cell lines were partially infected, and Venus-positive cells were monitored over time through flow cytometry (LSRFortessa, BD), starting on Day 0 (post-infection Day 5) and continuing with measurements at Days 4, 8, 11, 16, and 21.

Article Title:
Article Snippet: .. Briefly, two guide RNAs targeting the RTN4 gene were cloned into lentiCRISPR v2 backbone (Addgene plasmid #52961). ..

Article Title: Supporting Information for Liver cancer development driven by the AP-1/c-Jun~Fra-2 dimer through c- Myc
Article Snippet: .. To delete the c-MYC (WRE) enhancer, two flanking CRISPR guides were designed (sg_1: GCCCCTTTGTGGCCTAGGGC and sg_2: GCCCTAGGCCACAAAGGGGC) and cloned into the lentiCRISPR v2 backbone containing a puromycin selection cassette (Addgene#52961) and the resulting plasmid transfected in HepG2 cells using Xtreme gene (Sigma). ..

Derivative Assay:

Selection:

Sequencing:

Article Title: Targeting the ferritinophagy-lysosome axis as a therapeutic vulnerability in gastroenteropancreatic neuroendocrine tumors
Article Snippet: .. The sgRNAs were cloned into the lentiCRISPR v2 backbone (Addgene Cat #52961) and expanded in One Shot Stbl3 chemically competent E. coli (ThermoFisher Scientific). sgRNA containing plasmids were verified by Sanger sequencing. ..

Clone Assay:

Article Title: Inhibition of V-ATPase function drives apoptosis via GCN1/GCN2 kinase signaling
Article Snippet: Isogenic KO cell lines in HAP-1, Nalm-6 and HCT-116 (if not published previously) were generated using lentiviral delivery of Cas9 and the sgRNA using the lentiCRISPR V2 backbone (#52961, Addgene) .sgRNA sequences were designed with VBCscore and ordered at Microsynth Austria. .. They were subsequently cloned into the lentiCRISPR V2 backbone, following the protocol provided by Addgene. .. Whether the sgRNA was cloned correctly into the vector backbone was confirmed by Sanger sequencing (Microsynth Austria).

Article Title:
Article Snippet: .. Briefly, two guide RNAs targeting the RTN4 gene were cloned into lentiCRISPR v2 backbone (Addgene plasmid #52961). ..

Article Title: Multi-omics analysis reveals distinct non-reversion mechanisms of PARPi resistance in BRCA1- versus BRCA2-deficient mammary tumors
Article Snippet: .. Shld2 gene-editing For CRISPR/Cas9-mediated genome editing of Shld2, sgRNAs were cloned into a modified version of the lentiCRISPR v2 backbone (RRID: Addgene_52961) in which a puromycin resistance ORF was cloned under the hPGK promoter, or into the pX330.puro backbone (Addgene #110403). .. Cloning of sgRNAs into the lentiCRISPR v2 backbone was carried out by melting the custom DNA oligos (Microsynth) at 95 C for 5 min, followed by annealing at RT for 2h and subsequently ligation with T4 ligase (NEB) into the BsmBI-digested (Fermantas) backbone.

CRISPR:

Modification:

Transfection:

Generated:

Article Title: Inhibition of V-ATPase function drives apoptosis via GCN1/GCN2 kinase signaling
Article Snippet: Compounds use in this study include: Ǫ-VD-OPH (CAY15260-1, Cayman Chemicals), used at a concentration of 10 μM; GCN2iB (HY-112654, MedChemExpress) used at a concentration of 10 μM; ABT-737 (HY-50907, MedChemExpress) and ABT-199 (HY-15531, MedChemExpress) used at indicated concentrations .. Isogenic KO cell lines in HAP-1, Nalm-6 and HCT-116 (if not published previously) were generated using lentiviral delivery of Cas9 and the sgRNA using the lentiCRISPR V2 backbone (#52961, Addgene) .sgRNA sequences were designed with VBCscore and ordered at Microsynth Austria. .. They were subsequently cloned into the lentiCRISPR V2 backbone, following the protocol provided by Addgene.

Review