lenticrispr v2 backbone (Addgene inc)
96
Structured Review
Addgene inc
lenticrispr v2 backbone
Lenticrispr V2 Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 6145 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrispr+v2+backbone/lentiCRISPR+v2+(Plasmid+%2352961)/bio_rxiv__64898__2026__03__27__714872-282-6-14
Average 96 stars, based on 6145 article reviews
Lenticrispr V2 Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 6145 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrispr+v2+backbone/lentiCRISPR+v2+(Plasmid+%2352961)/bio_rxiv__64898__2026__03__27__714872-282-6-14
Average 96 stars, based on 6145 article reviews
lenticrispr v2 backbone - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: Genome-wide CRISPR screen identifies BUB1 kinase as a druggable vulnerability in malignant pleural mesothelioma. Article Snippet: .. The gRNAs were inserted into the pECPV plasmid (EFS-Cas9-P2A-Venus), derived from the Article Title: Genome-wide CRISPR screen identifies BUB1 kinase as a druggable vulnerability in malignant pleural mesothelioma Article Snippet: .. The gRNAs were inserted into the pECPV plasmid (EFS-Cas9-P2A-Venus), derived from the Article Title: Article Snippet: .. Briefly, two guide RNAs targeting the RTN4 gene were cloned into Article Title: Supporting Information for Liver cancer development driven by the AP-1/c-Jun~Fra-2 dimer through c- Myc Article Snippet: .. To delete the c-MYC (WRE) enhancer, two flanking CRISPR guides were designed (sg_1: GCCCCTTTGTGGCCTAGGGC and sg_2: GCCCTAGGCCACAAAGGGGC) and cloned into the Derivative Assay:Article Title: Genome-wide CRISPR screen identifies BUB1 kinase as a druggable vulnerability in malignant pleural mesothelioma. Article Snippet: .. The gRNAs were inserted into the pECPV plasmid (EFS-Cas9-P2A-Venus), derived from the Article Title: Genome-wide CRISPR screen identifies BUB1 kinase as a druggable vulnerability in malignant pleural mesothelioma Article Snippet: .. The gRNAs were inserted into the pECPV plasmid (EFS-Cas9-P2A-Venus), derived from the Selection:Article Title: Genome-wide CRISPR screen identifies BUB1 kinase as a druggable vulnerability in malignant pleural mesothelioma. Article Snippet: .. The gRNAs were inserted into the pECPV plasmid (EFS-Cas9-P2A-Venus), derived from the Article Title: Genome-wide CRISPR screen identifies BUB1 kinase as a druggable vulnerability in malignant pleural mesothelioma Article Snippet: .. The gRNAs were inserted into the pECPV plasmid (EFS-Cas9-P2A-Venus), derived from the Article Title: Supporting Information for Liver cancer development driven by the AP-1/c-Jun~Fra-2 dimer through c- Myc Article Snippet: .. To delete the c-MYC (WRE) enhancer, two flanking CRISPR guides were designed (sg_1: GCCCCTTTGTGGCCTAGGGC and sg_2: GCCCTAGGCCACAAAGGGGC) and cloned into the Sequencing:Article Title: Genome-wide CRISPR screen identifies BUB1 kinase as a druggable vulnerability in malignant pleural mesothelioma. Article Snippet: .. The gRNAs were inserted into the pECPV plasmid (EFS-Cas9-P2A-Venus), derived from the Article Title: Genome-wide CRISPR screen identifies BUB1 kinase as a druggable vulnerability in malignant pleural mesothelioma Article Snippet: .. The gRNAs were inserted into the pECPV plasmid (EFS-Cas9-P2A-Venus), derived from the Article Title: Targeting the ferritinophagy-lysosome axis as a therapeutic vulnerability in gastroenteropancreatic neuroendocrine tumors Article Snippet: .. The sgRNAs were cloned into the Clone Assay:Article Title: Inhibition of V-ATPase function drives apoptosis via GCN1/GCN2 kinase signaling Article Snippet: Isogenic KO cell lines in HAP-1, Nalm-6 and HCT-116 (if not published previously) were generated using lentiviral delivery of Cas9 and the sgRNA using the lentiCRISPR V2 backbone (#52961, Addgene) .sgRNA sequences were designed with VBCscore and ordered at Microsynth Austria. .. They were subsequently cloned into the Article Title: Article Snippet: .. Briefly, two guide RNAs targeting the RTN4 gene were cloned into Article Title: Multi-omics analysis reveals distinct non-reversion mechanisms of PARPi resistance in BRCA1- versus BRCA2-deficient mammary tumors Article Snippet: .. Shld2 gene-editing For CRISPR/Cas9-mediated genome editing of Shld2, sgRNAs were cloned into a modified version of the Article Title: Supporting Information for Liver cancer development driven by the AP-1/c-Jun~Fra-2 dimer through c- Myc Article Snippet: .. To delete the c-MYC (WRE) enhancer, two flanking CRISPR guides were designed (sg_1: GCCCCTTTGTGGCCTAGGGC and sg_2: GCCCTAGGCCACAAAGGGGC) and cloned into the Article Title: Targeting the ferritinophagy-lysosome axis as a therapeutic vulnerability in gastroenteropancreatic neuroendocrine tumors Article Snippet: .. The sgRNAs were cloned into the CRISPR:Article Title: Multi-omics analysis reveals distinct non-reversion mechanisms of PARPi resistance in BRCA1- versus BRCA2-deficient mammary tumors Article Snippet: .. Shld2 gene-editing For CRISPR/Cas9-mediated genome editing of Shld2, sgRNAs were cloned into a modified version of the Article Title: Supporting Information for Liver cancer development driven by the AP-1/c-Jun~Fra-2 dimer through c- Myc Article Snippet: .. To delete the c-MYC (WRE) enhancer, two flanking CRISPR guides were designed (sg_1: GCCCCTTTGTGGCCTAGGGC and sg_2: GCCCTAGGCCACAAAGGGGC) and cloned into the Modification:Article Title: Multi-omics analysis reveals distinct non-reversion mechanisms of PARPi resistance in BRCA1- versus BRCA2-deficient mammary tumors Article Snippet: .. Shld2 gene-editing For CRISPR/Cas9-mediated genome editing of Shld2, sgRNAs were cloned into a modified version of the Transfection:Article Title: Supporting Information for Liver cancer development driven by the AP-1/c-Jun~Fra-2 dimer through c- Myc Article Snippet: .. To delete the c-MYC (WRE) enhancer, two flanking CRISPR guides were designed (sg_1: GCCCCTTTGTGGCCTAGGGC and sg_2: GCCCTAGGCCACAAAGGGGC) and cloned into the Generated:Article Title: Inhibition of V-ATPase function drives apoptosis via GCN1/GCN2 kinase signaling Article Snippet: Compounds use in this study include: Ǫ-VD-OPH (CAY15260-1, Cayman Chemicals), used at a concentration of 10 μM; GCN2iB (HY-112654, MedChemExpress) used at a concentration of 10 μM; ABT-737 (HY-50907, MedChemExpress) and ABT-199 (HY-15531, MedChemExpress) used at indicated concentrations .. Isogenic KO cell lines in HAP-1, Nalm-6 and HCT-116 (if not published previously) were generated using lentiviral delivery of Cas9 and the sgRNA using the |